Skip to main content

DD-DamV133A-LMNB1-IRES2-mCherry
(Plasmid #159599)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159599 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 159599-D50 50 μg of DNA in Tris buffer $495
DNA 159599-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 8227
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DD-DamV133A-LMNB1-IRES2-mCherry
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4400
  • Mutation
    Dam V133A mutation
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV-F (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer IRES-R (CCTCACATTGCCAAAAGACG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    modified from a gift from Bas van Steensel

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

dam-/dcm- strain should be used for downstream applications

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DD-DamV133A-LMNB1-IRES2-mCherry was a gift from Aaron Streets (Addgene plasmid # 159599 ; http://n2t.net/addgene:159599 ; RRID:Addgene_159599)
  • For your References section:

    muDamID: A Microfluidic Approach for Joint Imaging and Sequencing of Protein-DNA Interactions in Single Cells. Altemose N, Maslan A, Rios-Martinez C, Lai A, White JA, Streets A. Cell Syst. 2020 Oct 21;11(4):354-366.e9. doi: 10.1016/j.cels.2020.08.015. Epub 2020 Sep 23. 10.1016/j.cels.2020.08.015 PubMed 33099405