Skip to main content

DD-DamWT-LMNB1-IRES2-mCherry
(Plasmid #159601)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159601 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 8227
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DD-DamWT-LMNB1-IRES2-mCherry
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4400
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV-F (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer IRES-R (CCTCACATTGCCAAAAGACG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    modified from a gift from Bas van Steensel
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

dam-/dcm- strain should be used for downstream applications

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DD-DamWT-LMNB1-IRES2-mCherry was a gift from Aaron Streets (Addgene plasmid # 159601 ; http://n2t.net/addgene:159601 ; RRID:Addgene_159601)
  • For your References section:

    muDamID: A Microfluidic Approach for Joint Imaging and Sequencing of Protein-DNA Interactions in Single Cells. Altemose N, Maslan A, Rios-Martinez C, Lai A, White JA, Streets A. Cell Syst. 2020 Oct 21;11(4):354-366.e9. doi: 10.1016/j.cels.2020.08.015. Epub 2020 Sep 23. 10.1016/j.cels.2020.08.015 PubMed 33099405