DD-DamV133A-tdTomato-LMNB1
(Plasmid
#159604)
-
PurposeShield-1 inducible transient mammalian expression of Dam-tdTomato-LMNB1 for DamID, containing the V133A mutant of Dam and a fused tdTomato to monitor fusion protein localization and expression levels.
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159604 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 159604-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 159604-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 8347
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDD-DamV133A-tdTomato-LMNB1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4500
-
MutationDam V133A mutation
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV-F (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer SV40pA-R (GAAATTTGTGATGCTATTGC)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymodified from a gift from Bas van Steensel
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
dam-/dcm- strain should be used for downstream applications
DNA (Catalog # 159604-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 159604-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DD-DamV133A-tdTomato-LMNB1 was a gift from Aaron Streets (Addgene plasmid # 159604 ; http://n2t.net/addgene:159604 ; RRID:Addgene_159604) -
For your References section:
muDamID: A Microfluidic Approach for Joint Imaging and Sequencing of Protein-DNA Interactions in Single Cells. Altemose N, Maslan A, Rios-Martinez C, Lai A, White JA, Streets A. Cell Syst. 2020 Oct 21;11(4):354-366.e9. doi: 10.1016/j.cels.2020.08.015. Epub 2020 Sep 23. 10.1016/j.cels.2020.08.015 PubMed 33099405