Skip to main content

AAVS1-Blasticidin XLone-eGFP
(Plasmid #159754)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 159754 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    AAVS1-Blasticidin-CAG-Flpe-ERT2
  • Backbone manufacturer
    Addgene #68461
  • Backbone size w/o insert (bp) 8381
  • Total vector size (bp) 10858
  • Vector type
    Mammalian Expression, CRISPR, TALEN ; Donor plasmid for targeted knockin at the S1 safe harbor locus
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    all-in-one tet-on system
  • Alt name
    Xlone
  • Species
    Synthetic
  • Insert Size (bp)
    2474
  • Promoter TRE3GS inducible promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer gcgcctataaaagagtgctga
  • 3′ sequencing primer cgcctgtcttaggttggagt
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene QC identified a discrepancy in the TetO array of the promoter compared the expected reference sequence. The construct is verified by the depositing lab as functional for inducible expression of eGFP in 293T cells.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-Blasticidin XLone-eGFP was a gift from Xiaoping Bao (Addgene plasmid # 159754 ; http://n2t.net/addgene:159754 ; RRID:Addgene_159754)
  • For your References section:

    Chemically-defined generation of human hemogenic endothelium and definitive hematopoietic progenitor cells. Chang Y, Syahirah R, Oprescu SN, Wang X, Jung J, Cooper SH, Torregrosa-Allen S, Elzey BD, Hsu AY, Randolph LN, Sun Y, Kuang S, Broxmeyer HE, Deng Q, Lian X, Bao X. Biomaterials. 2022 May 6;285:121569. doi: 10.1016/j.biomaterials.2022.121569. 10.1016/j.biomaterials.2022.121569 PubMed 35567999