AAVS1-Blasticidin XLone-eGFP
(Plasmid
#159754)
-
PurposeAAVS1 donor plasmid for targeted inducible eGFP expression in human cells
-
Depositing Lab
-
Depositing OrganizationPurdue University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159754 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAAVS1-Blasticidin-CAG-Flpe-ERT2
-
Backbone manufacturerAddgene #68461
- Backbone size w/o insert (bp) 8381
- Total vector size (bp) 10858
-
Vector typeMammalian Expression, CRISPR, TALEN ; Donor plasmid for targeted knockin at the S1 safe harbor locus
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameall-in-one tet-on system
-
Alt nameXlone
-
SpeciesSynthetic
-
Insert Size (bp)2474
- Promoter TRE3GS inducible promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer gcgcctataaaagagtgctga
- 3′ sequencing primer cgcctgtcttaggttggagt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene QC identified a discrepancy in the TetO array of the promoter compared the expected reference sequence. The construct is verified by the depositing lab as functional for inducible expression of eGFP in 293T cells.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Blasticidin XLone-eGFP was a gift from Xiaoping Bao (Addgene plasmid # 159754 ; http://n2t.net/addgene:159754 ; RRID:Addgene_159754) -
For your References section:
Chemically-defined generation of human hemogenic endothelium and definitive hematopoietic progenitor cells. Chang Y, Syahirah R, Oprescu SN, Wang X, Jung J, Cooper SH, Torregrosa-Allen S, Elzey BD, Hsu AY, Randolph LN, Sun Y, Kuang S, Broxmeyer HE, Deng Q, Lian X, Bao X. Biomaterials. 2022 May 6;285:121569. doi: 10.1016/j.biomaterials.2022.121569. 10.1016/j.biomaterials.2022.121569 PubMed 35567999