Skip to main content

vYM082_PB-pEF1s(min)-3xNLS-Citrine-T2A-iaaH(Hygro)
(Plasmid #160044)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160044 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 160044-D50 50 μg of DNA in Tris buffer $495
DNA 160044-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    PiggyBac
  • Backbone manufacturer
    SYSTEM BIOSCIENCE
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    iaaH
  • Entrez Gene
    iaaH (a.k.a. HXC48_RS00895, pTi-SAKURA_p184)
  • Promoter pEF1s
  • Tag / Fusion Protein
    • 3xNLS-Citrine (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGGAGTAGCCATCACGTCACTGGC
  • 3′ sequencing primer GGTGTTCGGAAGTCCAGCGAAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    vYM082_PB-pEF1s(min)-3xNLS-Citrine-T2A-iaaH(Hygro) was a gift from Michael Elowitz (Addgene plasmid # 160044 ; http://n2t.net/addgene:160044 ; RRID:Addgene_160044)
  • For your References section:

    Synthetic mammalian signaling circuits for robust cell population control. Ma Y, Budde MW, Mayalu MN, Zhu J, Lu AC, Murray RM, Elowitz MB. Cell. 2022 Mar 17;185(6):967-979.e12. doi: 10.1016/j.cell.2022.01.026. Epub 2022 Mar 1. 10.1016/j.cell.2022.01.026 PubMed 35235768