Skip to main content

pTXB1-Tn5-F
(Plasmid #160081)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160081 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pTXB1
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 6706
  • Total vector size (bp) 8106
  • Modifications to backbone
    None
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Growth at 37°C before IPTG induction. After IPTG addition, grow at 30°C. The Rosetta2 E. coli strain is used for protein expression.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tn5 transposase
  • Species
    Synthetic
  • Insert Size (bp)
    1428
  • Tags / Fusion Proteins
    • FLAG (C terminal on insert)
    • Mxe intein - Chitin-binding domain (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer T7 promoter primer
  • 3′ sequencing primer GATTGCCATGCCGGTCAAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pTXB1-Tn5 (Addgene #60240)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTXB1-Tn5-F was a gift from Pier Pandolfi (Addgene plasmid # 160081 ; http://n2t.net/addgene:160081 ; RRID:Addgene_160081)
  • For your References section:

    Dual DNA and protein tagging of open chromatin unveils dynamics of epigenomic landscapes in leukemia. Lee JD, Paulo JA, Posey RR, Mugoni V, Kong NR, Cheloni G, Lee YR, Slack FJ, Tenen DG, Clohessy JG, Gygi SP, Pandolfi PP. Nat Methods. 2021 Mar;18(3):293-302. doi: 10.1038/s41592-021-01077-8. Epub 2021 Mar 1. 10.1038/s41592-021-01077-8 PubMed 33649590