pTXB1-TP2
(Plasmid
#160085)
-
PurposeBacterial expression of Tn5-APEX2 fusion protein with linker PAPAP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160085 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTXB1
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 6706
- Total vector size (bp) 8868
-
Modifications to backboneNone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrowth at 37°C before IPTG induction. After IPTG addition, grow at 30°C. The Rosetta2 E. coli strain is used for protein expression.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTn5 transposase/APEX2 peroxidase fusion protein
-
SpeciesSynthetic
-
Insert Size (bp)2190
-
Tags
/ Fusion Proteins
- FLAG (C terminal on insert)
- Mxe intein - Chitin-binding domain (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7 promoter primer
- 3′ sequencing primer GATTGCCATGCCGGTCAAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypTXB1-Tn5 (Addgene #60240) and pTRC-APEX2 (Addgene #72558)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTXB1-TP2 was a gift from Pier Pandolfi (Addgene plasmid # 160085 ; http://n2t.net/addgene:160085 ; RRID:Addgene_160085) -
For your References section:
Dual DNA and protein tagging of open chromatin unveils dynamics of epigenomic landscapes in leukemia. Lee JD, Paulo JA, Posey RR, Mugoni V, Kong NR, Cheloni G, Lee YR, Slack FJ, Tenen DG, Clohessy JG, Gygi SP, Pandolfi PP. Nat Methods. 2021 Mar;18(3):293-302. doi: 10.1038/s41592-021-01077-8. Epub 2021 Mar 1. 10.1038/s41592-021-01077-8 PubMed 33649590