-
PurposeContains 10 constitutively expressed guide RNAs and CAG-GFP-CARLIN array sequence for DNA barcoding (when used in combination with Cas9)
-
Depositing Lab
-
Depositing OrganizationBoston Children's Hospital
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 160928-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 160928-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBS31
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 12710
-
Vector typeMammalian Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCARLIN gRNAs and CAG-GFP-CARLIN array
-
Insert Size (bp)4502
- Promoter U6 promoter for gRNAs; CAG promoter for GFP
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CARLIN array fw: GAGCTGTACAAGTAAGCGGC
- 3′ sequencing primer CARLIN array rv: GCAACTAGAAGGCACAGTCG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 160928-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 160928-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS31-cCARLIN was a gift from Fernando Camargo (Addgene plasmid # 160928 ; http://n2t.net/addgene:160928 ; RRID:Addgene_160928) -
For your References section:
An Engineered CRISPR-Cas9 Mouse Line for Simultaneous Readout of Lineage Histories and Gene Expression Profiles in Single Cells. Bowling S, Sritharan D, Osorio FG, Nguyen M, Cheung P, Rodriguez-Fraticelli A, Patel S, Yuan WC, Fujiwara Y, Li BE, Orkin SH, Hormoz S, Camargo FD. Cell. 2020 Jun 11;181(6):1410-1422.e27. doi: 10.1016/j.cell.2020.04.048. Epub 2020 May 14. 10.1016/j.cell.2020.04.048 PubMed 32413320