Skip to main content

pBS31-cCARLIN
(Plasmid #160928)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160928 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 160928-D50 50 μg of DNA in Tris buffer $495
DNA 160928-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pBS31
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 12710
  • Vector type
    Mammalian Expression, Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CARLIN gRNAs and CAG-GFP-CARLIN array
  • Insert Size (bp)
    4502
  • Promoter U6 promoter for gRNAs; CAG promoter for GFP

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CARLIN array fw: GAGCTGTACAAGTAAGCGGC
  • 3′ sequencing primer CARLIN array rv: GCAACTAGAAGGCACAGTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBS31-cCARLIN was a gift from Fernando Camargo (Addgene plasmid # 160928 ; http://n2t.net/addgene:160928 ; RRID:Addgene_160928)
  • For your References section:

    An Engineered CRISPR-Cas9 Mouse Line for Simultaneous Readout of Lineage Histories and Gene Expression Profiles in Single Cells. Bowling S, Sritharan D, Osorio FG, Nguyen M, Cheung P, Rodriguez-Fraticelli A, Patel S, Yuan WC, Fujiwara Y, Li BE, Orkin SH, Hormoz S, Camargo FD. Cell. 2020 Jun 11;181(6):1410-1422.e27. doi: 10.1016/j.cell.2020.04.048. Epub 2020 May 14. 10.1016/j.cell.2020.04.048 PubMed 32413320