Skip to main content

pJM410 ZF1x6-C mKate2 in TUPV1
(Plasmid #161526)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161526 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 161526-D50 50 μg of DNA in Tris buffer $495
DNA 161526-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pPD471 CMV MCS (TUPV1)
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mKate2
  • Species
    Synthetic
  • Promoter ZF1x6-C

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGACACGGAAATGTTGAATAC
  • 3′ sequencing primer CAGTGGGAGTGGCACCTTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJM410 ZF1x6-C mKate2 in TUPV1 was a gift from Joshua Leonard (Addgene plasmid # 161526 ; http://n2t.net/addgene:161526 ; RRID:Addgene_161526)
  • For your References section:

    Model-guided design of mammalian genetic programs. Muldoon JJ, Kandula V, Hong M, Donahue PS, Boucher JD, Bagheri N, Leonard JN. Sci Adv. 2021 Feb 19;7(8). pii: 7/8/eabe9375. doi: 10.1126/sciadv.abe9375. Print 2021 Feb. 10.1126/sciadv.abe9375 PubMed 33608279