pICE-EGFP-FLAG-TK1
(Plasmid
#161919)
-
PurposeExpresses human TK1 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.
-
Depositing Lab
-
Depositing OrganizationCNRS UMR 5089, Institute of Pharmacology and Structural Biology (IPBS)
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 161919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 161919-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 161919-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepICE-EGFP-FLAG+(Ku70siR-WT)
-
Backbone manufacturerAddgene #46961
- Backbone size w/o insert (bp) 5743
- Total vector size (bp) 6445
-
Modifications to backboneReplaced Ku70 by TK1
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameThymidine kinase, cytosolic
-
SpeciesH. sapiens (human)
-
Insert Size (bp)702
-
Entrez GeneTK1 (a.k.a. TK2)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP-FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer SEQ-GFPC-F (CATGGTCCTGCTGGAGTTCGTG)
- 3′ sequencing primer SEQ-BGH-R (TAGAAGGCACAGTCGAGG)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 161919-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 161919-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICE-EGFP-FLAG-TK1 was a gift from Sébastien Britton (Addgene plasmid # 161919 ; http://n2t.net/addgene:161919 ; RRID:Addgene_161919) -
For your References section:
SDR enzymes oxidize specific lipidic alkynylcarbinols into cytotoxic protein-reactive species. Demange P, Joly E, Marcoux J, Zanon PRA, Listunov D, Rulliere P, Barthes C, Noirot C, Izquierdo JB, Rozie A, Pradines K, Hee R, de Brito MV, Marcellin M, Serre RF, Bouchez O, Burlet-Schiltz O, Oliveira MCF, Ballereau S, Bernardes-Genisson V, Maraval V, Calsou P, Hacker SM, Genisson Y, Chauvin R, Britton S. Elife. 2022 May 10;11. pii: 73913. doi: 10.7554/eLife.73913. 10.7554/eLife.73913 PubMed 35535493