Skip to main content

pX330 L-FKBP-Cas9
(Plasmid #162728)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162728 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 162728-D50 50 μg of DNA in Tris buffer $495
DNA 162728-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUC ori vector, pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FKBP F36V
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    321
  • Promoter CBh
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330 L-FKBP-Cas9 was a gift from Amit Choudhary (Addgene plasmid # 162728 ; http://n2t.net/addgene:162728 ; RRID:Addgene_162728)
  • For your References section:

    Chemogenetic System Demonstrates That Cas9 Longevity Impacts Genome Editing Outcomes. Sreekanth V, Zhou Q, Kokkonda P, Bermudez-Cabrera HC, Lim D, Law BK, Holmes BR, Chaudhary SK, Pergu R, Leger BS, Walker JA, Gifford DK, Sherwood RI, Choudhary A. ACS Cent Sci. 2020 Dec 23;6(12):2228-2237. doi: 10.1021/acscentsci.0c00129. Epub 2020 Nov 18. 10.1021/acscentsci.0c00129 PubMed 33376784