gRNA_SRR124.5_tagBFP
(Plasmid
#163753)
-
PurposegRNA expression vector containing the tagBFP fluorescent marker to target the region upstream of the SRR124 SOX2 enhancer in human cells.
-
Depositing Lab
-
Depositing OrganizationUniversity of Toronto
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163753 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 163753-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 163753-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonegRNA_CloningVector_tagBFP
- Backbone size w/o insert (bp) 4916
- Total vector size (bp) 4976
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA_SRR124.5
-
gRNA/shRNA sequenceGACTACTACCTGGCATAACC
-
SpeciesH. sapiens (human)
- Promoter U6
-
Tag
/ Fusion Protein
- tagBFP (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer ATTTAGGTGACACTATAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA_CloningVector_tagBFP (Addgene Plasmid #163747) was modified to insert the target sequence upstream of the SRR124 SOX2 enhancer (GACTACTACCTGGCATAACC). Use this gRNA plasmid together with Addgene Plasmid #163754 to knock-out SRR124 and SRR134 enhancers from human cells.
DNA (Catalog # 163753-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 163753-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNA_SRR124.5_tagBFP was a gift from Jennifer Mitchell (Addgene plasmid # 163753 ; http://n2t.net/addgene:163753 ; RRID:Addgene_163753) -
For your References section:
Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Abatti LE, Lado-Fernandez P, Huynh L, Collado M, Hoffman MM, Mitchell JA. Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734. 10.1093/nar/gkad734 PubMed 37738673
Map uploaded by the depositor.
