pLV-CMV-LoxP-DsRed-LoxP-eGFP
(Plasmid #65726)

• Purpose: Functions as a genetic Cre reporter that switches from DsRed expression to eGFP expression upon presence of Cre recombinase.
• Depositing Lab: Jacco van Rheenen
• Publication: Zomer et al Cell. 2015 May 21;161(5):1046-57. doi: 10.1016/j.cell.2015.04.042.

Backbone

• Vector backbone: pLV
• Total vector size (bp): 9997
• Vector type: Mammalian Expression, Lentiviral, Cre/Lox
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LoxP-DsRed-LoxP-eGFP
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sall (not destroyed)
• 3′ cloning site: Spel (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg

Resource Information

• Supplemental Documents:
  • DNA star sequence builder file of pLV-CMV-LoxP-DsRed-LoxP-eGFP
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 12 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry