Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Cre Reporter
(Plasmid #62732)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62732 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PHAGE2
  • Backbone size w/o insert (bp) 8171
  • Total vector size (bp) 9767
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LoxP-DsRED-STOP-LoxP-eGFP
  • Species
    Synthetic
  • Insert Size (bp)
    1577
  • Promoter EF1-Alpha
  • Tag / Fusion Protein
    • LoxP sites

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGTGGAGACTGAAGTTAGGCCAG
  • 3′ sequencing primer CAAGAAGACAGGGCCAGGTTTCCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cre Reporter was a gift from Niels Geijsen (Addgene plasmid # 62732 ; http://n2t.net/addgene:62732 ; RRID:Addgene_62732)
  • For your References section:

    Efficient Intracellular Delivery of Native Proteins. D'Astolfo DS, Pagliero RJ, Pras A, Karthaus WR, Clevers H, Prasad V, Lebbink RJ, Rehmann H, Geijsen N. Cell. 2015 Apr 23;161(3):674-690. doi: 10.1016/j.cell.2015.03.028. 10.1016/j.cell.2015.03.028 PubMed 25910214