Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Cre-IRES-PuroR
(Plasmid #30205)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 30205 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE2
  • Backbone size w/o insert (bp) 8164
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    LB broth at 37C, shaken at ~150 rotations/minute overnight.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cre recombinase
  • Species
    Enterobacteria phage P1
  • Insert Size (bp)
    1065
  • GenBank ID
    X03453
  • Entrez Gene
    cre (a.k.a. P1_gp003)
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not1 (not destroyed)
  • 3′ cloning site BamHI/BglII (destroyed during cloning)
  • 5′ sequencing primer GGTTCATTCTCAAGCCTCAGACAGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cre-IRES-PuroR was a gift from Darrell Kotton (Addgene plasmid # 30205 ; http://n2t.net/addgene:30205 ; RRID:Addgene_30205)
  • For your References section:

    Generation of transgene-free lung disease-specific human induced pluripotent stem cells using a single excisable lentiviral stem cell cassette. Somers A, Jean JC, Sommer CA, Omari A, Ford CC, Mills JA, Ying L, Sommer AG, Jean JM, Smith BW, Lafyatis R, Demierre MF, Weiss DJ, French DL, Gadue P, Murphy GJ, Mostoslavsky G, Kotton DN. Stem Cells. 2010 Oct . 28(10):1728-40. 10.1002/stem.495 PubMed 20715179