Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAGGS-flpE-puro
(Plasmid #20733)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 20733 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBS
  • Backbone size w/o insert (bp) 3176
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FlpE recombinase
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1416

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site SphI (not destroyed)
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer M13R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid runs as a multimer. Plasmid multimerization often does not impact plasmid function, but may reduce transformation efficiencies. If you need the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS-flpE-puro was a gift from Rudolf Jaenisch (Addgene plasmid # 20733 ; http://n2t.net/addgene:20733 ; RRID:Addgene_20733)
  • For your References section:

    Efficient method to generate single-copy transgenic mice by site-specific integration in embryonic stem cells. Beard C, Hochedlinger K, Plath K, Wutz A, Jaenisch R. Genesis. 2006 Jan . 44(1):23-8. 10.1002/gene.20180 PubMed 16400644