-
PurposeTransient Reporter for Editing Enrichment (TREE) Plasmid. GFP turns on with adenosine base editing (ABE). 1 stop codon.
-
Depositing Lab
-
Depositing OrganizationArizona State University
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164411 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 164411-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 164411-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneBackbone derived from pEF-GFP (Addgene #11154)
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
Alt nameRFP
- Promoter EF1-alpha
-
Tag
/ Fusion Protein
- T2A-GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAGTCGCCGTGAACGTTCTTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 164411-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 164411-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF-XMAS-1xStop was a gift from Xiao Wang (Addgene plasmid # 164411 ; http://n2t.net/addgene:164411 ; RRID:Addgene_164411) -
For your References section:
A Cas9-mediated adenosine transient reporter enables enrichment of ABE-targeted cells. Brookhouser N, Nguyen T, Tekel SJ, Standage-Beier K, Wang X, Brafman DA. BMC Biol. 2020 Dec 14;18(1):193. doi: 10.1186/s12915-020-00929-7. 10.1186/s12915-020-00929-7 PubMed 33317513