Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEF-ABEmax
(Plasmid #164415)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 164415 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Derived from pCMV-ABEmax (Addgene #112095)
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ABEmax
  • Alt name
    Cas9 Adenosine Base Editor max
  • Promoter EF1-alpha

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAGTCGCCGTGAACGTTCTTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF-ABEmax was a gift from Xiao Wang (Addgene plasmid # 164415 ; http://n2t.net/addgene:164415 ; RRID:Addgene_164415)
  • For your References section:

    A Cas9-mediated adenosine transient reporter enables enrichment of ABE-targeted cells. Brookhouser N, Nguyen T, Tekel SJ, Standage-Beier K, Wang X, Brafman DA. BMC Biol. 2020 Dec 14;18(1):193. doi: 10.1186/s12915-020-00929-7. 10.1186/s12915-020-00929-7 PubMed 33317513