pHSG1C3
(Plasmid
#164423)
-
Purposesingle guide RNA (sgRNA) and Prime editing guide RNA (pegRNA) cloning and mammalian cell expression. BbsI cloning for sgRNAs and BbsI/PstI for pegRNAs.
-
Depositing Lab
-
Depositing OrganizationArizona State University
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 164423-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 164423-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneDerived from pSB1C3
-
Backbone manufacturerRegistry of Standard Biological Parts
- Total vector size (bp) 2481
-
Modifications to backboneU6 promoter, sgRNA scaffold and restriction cloning sites.
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA
-
Alt namesingle guide RNA
-
gRNA/shRNA sequenceNon-targeted guide, BbsI restriction sites.
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site BbsI or PstI (unknown if destroyed)
- 5′ sequencing primer TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer AATACCGCCTTTGAGTGAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 164423-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 164423-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHSG1C3 was a gift from Xiao Wang (Addgene plasmid # 164423 ; http://n2t.net/addgene:164423 ; RRID:Addgene_164423) -
For your References section:
Prime Editing Guide RNA Design Automation Using PINE-CONE. Standage-Beier K, Tekel SJ, Brafman DA, Wang X. ACS Synth Biol. 2021 Feb 19;10(2):422-427. doi: 10.1021/acssynbio.0c00445. Epub 2021 Jan 19. 10.1021/acssynbio.0c00445 PubMed 33464043