Skip to main content

pET32a-Trx-His6-TEV_SacB
(Plasmid #164588)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164588 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pET32a(+)
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 7735
  • Modifications to backbone
    No
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TEV-SacB
  • Species
    B. subtilis
  • Insert Size (bp)
    2013
  • Promoter T7
  • Tag / Fusion Protein
    • Trx-His6 followed by TEV site (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gtaccgagaacctgtacttccaatccatg
  • 3′ sequencing primer cgaattcggatccgtatccacctttactg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The insert gene (SacB) was from Addgene plasmid #26103.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Designed and verified by Md Rezaul Karim (PhD), the responsible scientist. This plasmid is designed to clone a target gene replacing the sacB gene using CPEC (LIC) cloning. Growth media or agar plate with sucrose works as a negative selection marker for the intact template plasmid with the sacB gene and a positive selection marker for the successfully cloned plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET32a-Trx-His6-TEV_SacB was a gift from Ernst Schonbrunn (Addgene plasmid # 164588 ; http://n2t.net/addgene:164588 ; RRID:Addgene_164588)