pNTI743 dual-barcoded gRNA parent vector
(Plasmid
#164915)
-
Purpose(Empty Backbone) CEN/ARS Parent vector for constructing barcoded-gRNA CiBER-seq plasmid libraries
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164915 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepNTI661
- Backbone size (bp) 5024
-
Modifications to backboneAdded divergent yeast terminator sequences t(ADH1) and t(ACT1). Replaced NotI restriction site with AvrII restriction site.
-
Vector typeYeast Expression, CRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccttttgctggccttttgctc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See details in Muller et al for cloning barcoded gRNA libraries and ORFs of interest into this backbone.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNTI743 dual-barcoded gRNA parent vector was a gift from Nicholas Ingolia (Addgene plasmid # 164915 ; http://n2t.net/addgene:164915 ; RRID:Addgene_164915) -
For your References section:
CiBER-seq dissects genetic networks by quantitative CRISPRi profiling of expression phenotypes. Muller R, Meacham ZA, Ferguson L, Ingolia NT. Science. 2020 Dec 11;370(6522). pii: 370/6522/eabb9662. doi: 10.1126/science.abb9662. 10.1126/science.abb9662 PubMed 33303588