Skip to main content

pRB30-GFP
(Plasmid #165481)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165481 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pTriEx-1.1
  • Backbone manufacturer
    Novagen
  • Vector type
    Mammalian Expression
  • Tag / Fusion Protein
    • TEV-GFP-FLAG-10x His (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • TEV-GFP-FLAG-10x His (C terminal on backbone)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Primers for LIC cloning: Upstream: add TTAAGAAGGAGATATACT to the 5' end of gene of interest. Downstream: add GATTGGAAGTAGAGGTTCTCTGC to the 3' end of GOI. For vector: digest with BfuAI (BspMI) before LIC-treatment. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRB30-GFP was a gift from Renato Bruni (Addgene plasmid # 165481 ; http://n2t.net/addgene:165481 ; RRID:Addgene_165481)
  • For your References section:

    High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Bruni R, Kloss B. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34. doi: 10.1002/0471140864.ps2906s74. 10.1002/0471140864.ps2906s74 PubMed 24510647