pLENTICRISPR-LUC7L2-sgRNA2
(Plasmid
#165936)
-
PurposeCRISPR-mediated gene perturbation (knock-out) of LUC7L2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLENTICRISPR v2
-
Backbone manufacturerFeng Zhang, Addgene 52972
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLUC7L2
-
gRNA/shRNA sequenceCACCGGAGGAATCCCAGAAAGTAA
-
SpeciesH. sapiens (human)
-
Entrez GeneLUC7L2 (a.k.a. CGI-59, CGI-74, LUC7B2)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLENTICRISPR-LUC7L2-sgRNA2 was a gift from Vamsi Mootha (Addgene plasmid # 165936 ; http://n2t.net/addgene:165936 ; RRID:Addgene_165936) -
For your References section:
Loss of LUC7L2 and U1 snRNP subunits shifts energy metabolism from glycolysis to OXPHOS. Alexis A. Jourdain, Bridget E. Begg, Eran Mick, Hardik Shah, Sarah E. Calvo, Owen S. Skinner, Rohit Sharma, Steven M. Blue, Gene W. Yeo, Christopher B. Burge, Vamsi K. Mootha 8. Molecular Cell 10.1016/j.molcel.2021.02.033