pLPC-N-Myc-Flag-BirA-hPOT1
(Plasmid
#166409)
-
Purposeexpress BirA-hPOT1 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationNYU Grossman School of Medicine
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 166409-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 166409-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepLPC-N
- Backbone size w/o insert (bp) 5454
- Total vector size (bp) 8378
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehPOT1
-
Alt namePOT1
-
Alt nameCMM10, GLM9, HPOT1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2924
-
Entrez GenePOT1 (a.k.a. CMM10, CRMCC3, GLM9, HPOT1, PFBMFT8, TPDS3)
- Promoter cmv
-
Tags
/ Fusion Proteins
- myc (N terminal on backbone)
- flag (N terminal on backbone)
- BirA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NOT1 (unknown if destroyed)
- 3′ cloning site PAC1 (unknown if destroyed)
- 5′ sequencing primer GAACAAAAGTTGATTTCTGAAGAAGATTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 166409-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 166409-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLPC-N-Myc-Flag-BirA-hPOT1 was a gift from Agnel Sfeir (Addgene plasmid # 166409 ; http://n2t.net/addgene:166409 ; RRID:Addgene_166409) -
For your References section:
Replication stress conferred by POT1 dysfunction promotes telomere relocalization to the nuclear pore. Pinzaru AM, Kareh M, Lamm N, Lazzerini-Denchi E, Cesare AJ, Sfeir A. Genes Dev. 2020 Dec 1;34(23-24):1619-1636. doi: 10.1101/gad.337287.120. Epub 2020 Oct 29. 10.1101/gad.337287.120 PubMed 33122293