pMLC-BB1
(Plasmid
#166922)
-
PurposeBackbone for assembly of multi-level gene expression controllers
-
Depositing Lab
-
Depositing OrganizationUniversity of Bristol
Located in United Kingdom of Great Britain and Northern Ireland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166922 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 1708
- Total vector size (bp) 2721
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCyOFP - Orange fluorescent protein - flanked by BsaI sites
-
SpeciesSynthetic
-
Insert Size (bp)987
- Promoter J23100 constitutive
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer aaacaaataggggttccgcg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMLC-BB1 was a gift from Thomas Gorochowski (Addgene plasmid # 166922 ; http://n2t.net/addgene:166922 ; RRID:Addgene_166922) -
For your References section:
Harnessing the central dogma for stringent multi-level control of gene expression. Greco FV, Pandi A, Erb TJ, Grierson CS, Gorochowski TE. Nat Commun. 2021 Mar 19;12(1):1738. doi: 10.1038/s41467-021-21995-7. 10.1038/s41467-021-21995-7 PubMed 33741937