FASTHDR-Cterm-NanoLuc-Puromycin
(Plasmid
#167209)
-
Purpose(Empty Backbone) Plasmid to clone recombination arms to create homologous recombination donor vector for C-terminal gene tagging with NanoLuc and selection with Puromycin
-
Depositing Lab
-
Depositing OrganizationTemple University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167209 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepuc57
- Backbone size (bp) 2458
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
-
Tag
/ Fusion Protein
- NanoLuc (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Growth instructionsThe empty plasmid must be maintained in E.coli DB3.1. Once the plasmid is used to insert homologous recombination arms, the plasmid must be transformed in a strain that is sensitive to ccdb such as DH5Alpha or similar.
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcagattgtactgagagtgcaccata
- 3′ sequencing primer caggttttgctttttggcctttccc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FASTHDR-Cterm-NanoLuc-Puromycin was a gift from Oscar Perez (Addgene plasmid # 167209 ; http://n2t.net/addgene:167209 ; RRID:Addgene_167209) -
For your References section:
Multiplex Gene Tagging with CRISPR-Cas9 for Live-Cell Microscopy and Application to Study the Role of SARS-CoV-2 Proteins in Autophagy, Mitochondrial Dynamics, and Cell Growth. Perez-Leal O, Nixon-Abell J, Barrero CA, Gordon JC, Oesterling J, Rico MC. CRISPR J. 2021 Nov 30. doi: 10.1089/crispr.2021.0041. 10.1089/crispr.2021.0041 PubMed 34847745