Skip to main content
Addgene
Open Menu

pDS1928
(Plasmid #167284)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167284 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 167284-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 167284-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pBluescript
  • Selectable markers
    Nourseothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    red shifted luciferase
  • Species
    Synthetic
  • Insert Size (bp)
    1653
  • Promoter ACT1

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer AATTAACCCTCACTAAAGGG
  • 3′ sequencing primer CGTTCTTAATACTAACATAACT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    SAT1
  • Alt name
    dominant marker
  • Insert Size (bp)
    1828
  • Promoter ACT1

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TTTAAGGATAATGATCTGGG
  • 3′ sequencing primer CGACTCACTATAGGGCGAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDS1928 was a gift from Dominique Sanglard (Addgene plasmid # 167284 ; http://n2t.net/addgene:167284 ; RRID:Addgene_167284)

  • For your References section:

    Red-Shifted Firefly Luciferase Optimized for Candida albicans In vivo Bioluminescence Imaging. Dorsaz S, Coste AT, Sanglard D. Front Microbiol. 2017 Aug 3;8:1478. doi: 10.3389/fmicb.2017.01478. eCollection 2017. 10.3389/fmicb.2017.01478 PubMed 28824601
Related items:
Commonly requested with: