pCDH_blast_MCS_Nard_GFP_D50
(Plasmid
#167339)
-
PurposeExpresses GFP fused to progerin (d50) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167339 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCDH_blast_NCS_Nard
- Backbone size w/o insert (bp) 7208
- Total vector size (bp) 9812
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProgerin
-
Alt nameLaminAd50
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2614
-
Mutation50AA deletion creating Progerin instead of mature LMNA
-
GenBank IDAY357727.1
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AAATGTCGTAACAACTCCGC
- 3′ sequencing primer TCTCTAGGCACCCGTTCAAT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byNard Kubben
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/822858v4 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH_blast_MCS_Nard_GFP_D50 was a gift from Tom Misteli (Addgene plasmid # 167339 ; http://n2t.net/addgene:167339 ; RRID:Addgene_167339) -
For your References section:
Self-assembly of multi-component mitochondrial nucleoids via phase separation. Feric M, Demarest TG, Tian J, Croteau DL, Bohr VA, Misteli T. EMBO J. 2021 Mar 15;40(6):e107165. doi: 10.15252/embj.2020107165. Epub 2021 Feb 23. 10.15252/embj.2020107165 PubMed 33619770