Skip to main content
Addgene
Open Menu

HA, EGFP Spastin M87 with exon 4, N386C
(Plasmid #167543)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167543 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 167543-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 167543-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA5/FRT/TO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5137
  • Total vector size (bp) 7440
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Spastin M87 with exon 4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1593
  • Mutation
    N386C
  • GenBank ID
    NM_014946.3
  • Entrez Gene
    SPAST (a.k.a. ADPSP, FSP2, SPG4)
  • Promoter CMV
  • Tags / Fusion Proteins
    • HA tag (N terminal on backbone)
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HA, EGFP Spastin M87 with exon 4, N386C was a gift from Tarun Kapoor (Addgene plasmid # 167543 ; http://n2t.net/addgene:167543 ; RRID:Addgene_167543)

  • For your References section:

    Designing a chemical inhibitor for the AAA protein spastin using active site mutations. Cupido T, Pisa R, Kelley ME, Kapoor TM. Nat Chem Biol. 2019 May;15(5):444-452. doi: 10.1038/s41589-019-0225-6. Epub 2019 Feb 18. 10.1038/s41589-019-0225-6 PubMed 30778202
Related items:
Commonly requested with: