Skip to main content

miniTol2 x EF1a_EKAREN4(TA) + PGK-puro
(Plasmid #167826)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167826 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 167826-D50 50 μg of DNA in Tris buffer $495
DNA 167826-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    miniTol2 expression vector
  • Backbone size w/o insert (bp) 3450
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EKAREN4(TA)
  • Species
    Synthetic
  • Insert Size (bp)
    1950
  • Mutation
    K424P, K426W, T420A
  • Promoter EF1a
  • Tag / Fusion Protein
    • nls localization motif (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGGAATTTGCCCTTTTTGAG
  • 3′ sequencing primer AATGTTAACGACCGGt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    EKAREV (Komatsu et al.)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We received EKAREV FRET biosensor from Matsuda-lab (Japan). We subsequently improved by insertion of a Turquoise2 synthetic DNA, including 169 silent mutations (reducing recombination) and adapted the sensor domain by point mutagenesis. The generation of stable cell lines using this plasmid requires the co-transfection of a transposase-expressing plasmid. The depositing lab recommends the use of Plasmid 158774.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    miniTol2 x EF1a_EKAREN4(TA) + PGK-puro was a gift from Hugo Snippert (Addgene plasmid # 167826 ; http://n2t.net/addgene:167826 ; RRID:Addgene_167826)
  • For your References section:

    Quantifying single-cell ERK dynamics in colorectal cancer organoids reveals EGFR as an amplifier of oncogenic MAPK pathway signalling. Ponsioen B, Post JB, Buissant des Amorie JR, Laskaris D, van Ineveld RL, Kersten S, Bertotti A, Sassi F, Sipieter F, Cappe B, Mertens S, Verlaan-Klink I, Boj SF, Vries RGJ, Rehmann H, Vandenabeele P, Riquet FB, Trusolino L, Bos JL, Snippert HJG. Nat Cell Biol. 2021 Apr;23(4):377-390. doi: 10.1038/s41556-021-00654-5. Epub 2021 Apr 1. 10.1038/s41556-021-00654-5 PubMed 33795873