pUDE1084
(Plasmid #168500)

• Purpose: expression of T7RNA polymerase and CRISPR endonunclease Fncas12a
• Depositing Lab: Jean-Marc Daran
• Depositing Organization: Delft University of Technology
  Located in Netherlands
• Publication: Randazzo et al CRISPR J. 2021 Apr 23. doi: 10.1089/crispr.2020.0028.

Backbone

• Vector backbone: pGGKd034
• Backbone size w/o insert (bp): 5890
• Total vector size (bp): 13273
• Vector type: CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Fncas12a
• Species: Synthetic; Francisella tularensis subsp. novicida U112
• Insert Size (bp): 4038
• Promoter: TEF1

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCTCATAGCTTCAAAATGTTTCTACTCC

Gene/Insert 2

• Gene/Insert name: T7RNA polymerase
• Species: Bacteriophage T7
• Insert Size (bp): 2682
• Promoter: TDH3

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTACTAGCGTTGAATGTTAGCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Fncpf1 has been cloned from the Addgene plasmid #69976 (pY004) harbouring the human codon-optimized F. novicida cpf1 tagged with C-terminal nuclear localization signal (NLS) and 3xHA tag. (Zetsche B., Gootenberg J.S., Abudayyeh O.O., Slaymaker I.M., Makarova K.S., Essletzbichler P., Volz S.E., Joung J., van der Oost J., Regev A.et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell. 2015; 163:759–771.) The T7 RNA polymerase has been cloned from the Addgene plasmid #33152 (pRS315-nls-T7-RNAP) harbouring the NLS-T7RNApol gene (Dower, K. and Rosbash, M. (2002) T7 RNA polymerase-directed transcripts are processed in yeast and link 39 end formation to mRNA nuclear export. RNA, 8, 686-697)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 168500-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 168500-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.