pUDP012
(Plasmid #101167)

• Purpose: E. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)
• Depositing Lab: Jean-Marc Daran
• Publication: de Vries et al Microb Cell Fact. 2017 Dec 5;16(1):222. doi: 10.1186/s12934-017-0835-1.

Backbone

• Vector backbone: pUDP004
• Backbone manufacturer: JM Daran
• Backbone size w/o insert (bp): 10664
• Total vector size (bp): 10855
• Vector type: Yeast Expression, CRISPR
• Selectable markers: amdS (acetamidase gene conferring growth on acetamide)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HH-gRNA-HDV targetting SeILV6 in S. pastorianus
• gRNA/shRNA sequence: GGTCTCGCAAACAATTCCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCGAATTGCTTTTCTCTGATTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACACAGCGAGACC
• Species: S. cerevisiae (budding yeast); S. pastorianus
• GenBank ID: 1429090
• Promoter: ScTDH3

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: CGACAATCTAAGAACTATGCGAGG
• 3′ sequencing primer: CTGGCTATACCTATCCGTCTACG

Resource Information

• Supplemental Documents:
  • pUDP012.gb
• A portion of this plasmid was derived from a plasmid made by: The Spcas9D147Y P411T gene presents on pUDP004, pUDP012 and pUDP044 is derived from pCT (Plasmid #60620) obtained from Addgene under Material Transfer Agreement Instructions (Order 211742- our reference TNW15.216)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry