-
PurposeGenome engineering of virulent phages
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98841 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTRKL2
- Backbone size w/o insert (bp) 6419
- Total vector size (bp) 12221
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB5-alpha
-
Growth instructionsGrowth medium: BHI + Erythromycin 150 µg/ml.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametracr/Cas9
-
Insert Size (bp)5802
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCATATTAAACTAATTTCGGAGGTC
- 3′ sequencing primer CTGTATTACTGCATTTATTAAGAGTATTATACC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original gene was cloned by Luciano Marrafini and received from Addgene #42876.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note from the paper of O'Sullivan, and Klaenhammer: We found that BHI (Difco Laboratories, Detroit, MI, USA) was an excellent selection medium for ErR in E. coli. Unlike LB medium, BHI plates containing 150µg Er/ml afforded a clean selection, with no background colonies appearing even upon prolonged incubaction of one week or more.
O'Sullivan, D.J., T.R. Klaenhammer. 1993. High- and low-copy-number Lactococcus shuttle cloning vectors with features for clone screening. Gene 137:227-231.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL2Cas9 was a gift from Sylvain Moineau (Addgene plasmid # 98841 ; http://n2t.net/addgene:98841 ; RRID:Addgene_98841) -
For your References section:
Genome Engineering of Virulent Lactococcal Phages Using CRISPR-Cas9. Lemay ML, Tremblay DM, Moineau S. ACS Synth Biol. 2017 Mar 30. doi: 10.1021/acssynbio.6b00388. 10.1021/acssynbio.6b00388 PubMed 28324650