Rtn3S-GFP
(Plasmid
#169035)
-
PurposeExpress human Rtn3S in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Colorado, Boulder
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169035 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 169035-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 169035-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepAcGFP1-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 7726
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRtn3S
-
Alt nameRtn3a
-
SpeciesH. sapiens (human)
-
Insert Size (bp)712
-
GenBank IDNM_006054.4
-
Entrez GeneRTN3 (a.k.a. ASYIP, HAP, NSPL2, NSPLII, RTN3-A1)
- Promoter CMV
-
Tag
/ Fusion Protein
- acGFP1 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAAATGTGGTATGGCTGATT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 169035-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 169035-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Rtn3S-GFP was a gift from Gia Voeltz (Addgene plasmid # 169035 ; http://n2t.net/addgene:169035 ; RRID:Addgene_169035) -
For your References section:
Reticulon-3 Promotes Endosome Maturation at ER Membrane Contact Sites. Wu H, Voeltz GK. Dev Cell. 2021 Jan 11;56(1):52-66.e7. doi: 10.1016/j.devcel.2020.12.014. 10.1016/j.devcel.2020.12.014 PubMed 33434526