pME-ReaChR-citrine
(Plasmid
#169045)
-
PurposeMiddle entry vector for Gateway cloning that contains a ReaChR fused with citrine gene insert
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169045 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 169045-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 169045-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepENTR/D-TOPO
-
Backbone manufacturerThermoFischer
- Backbone size w/o insert (bp) 2709
- Total vector size (bp) 4469
-
Vector typeGateway Entry Cloning Vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameReaChR-citrine
-
SpeciesSynthetic
-
Insert Size (bp)1776
-
GenBank IDKF448069
-
Tag
/ Fusion Protein
- citrine (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTAAAACGACGGCCAG
- 3′ sequencing primer CATCAGAGATTTTGAGACAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene 50956
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 169045-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 169045-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pME-ReaChR-citrine was a gift from Paola Arlotta (Addgene plasmid # 169045 ; http://n2t.net/addgene:169045 ; RRID:Addgene_169045) -
For your References section:
Long-Range Optogenetic Control of Axon Guidance Overcomes Developmental Boundaries and Defects. Harris JM, Wang AY, Boulanger-Weill J, Santoriello C, Foianini S, Lichtman JW, Zon LI, Arlotta P. Dev Cell. 2020 Jun 8;53(5):577-588.e7. doi: 10.1016/j.devcel.2020.05.009. 10.1016/j.devcel.2020.05.009 PubMed 32516597