tetO-MyoD-T2A-GFPnls-mPGK-rtTA-IRES-Puro
(Plasmid
#69546)
-
PurposeTet-On system expressing MyoD-2A-GFP-2xNLS.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRRL
- Total vector size (bp) 11004
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameeGFP
-
Alt nameEnhanced green fluorescent protein
-
SpeciesSynthetic
-
Tags
/ Fusion Proteins
- 2x nuclear localization sequence (C terminal on insert)
- T2A "skipping" peptide (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NsiI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CCCAATGCGATTTATCAGGT
- 3′ sequencing primer gacgtgaagaatgtgcgaga (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMyod1
-
Alt nameMyoD
-
SpeciesM. musculus (mouse)
-
MutationRemoved stop codon to fuse it to the 2A-eGFPnls insert.
-
GenBank IDNM_010866.2
-
Entrez GeneMyod1 (a.k.a. MYF3, MyoD, Myod-1, bHLHc1)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer tacggtgggaggcctatataagca
- 3′ sequencing primer GACCAGGATGGGCACCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tetO-MyoD-T2A-GFPnls-mPGK-rtTA-IRES-Puro was a gift from Charles Gersbach (Addgene plasmid # 69546 ; http://n2t.net/addgene:69546 ; RRID:Addgene_69546)