-
PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into skeletal muscle cells via MYOD1 and shOCT4 expression
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182309 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUCM
- Backbone size w/o insert (bp) 13225
- Total vector size (bp) 14758
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMYOD1-shOct4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1492
-
MutationshOct4
-
Entrez GeneMYOD1 (a.k.a. CMYP17, MYF3, MYOD, MYODRIF, PUM, bHLHc1)
- Promoter TRE3G
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NruI (unknown if destroyed)
- 5′ sequencing primer ccgtaccacttcctaccctc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepuro-T2A-mycNLS-mTagBFP2
-
Insert Size (bp)1474
- Promoter EF1a
-
Tag
/ Fusion Protein
- T2A-mycNLS-mTagBFP2
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SwaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TO-MYOD1-shOct4 was a gift from iPSC Neurodegenerative Disease Initiative (iNDI) & Michael Ward (Addgene plasmid # 182309 ; http://n2t.net/addgene:182309 ; RRID:Addgene_182309)