PB-TO-MYOD1-shOct4
(Plasmid #182309)

• Purpose: Piggybac Tet-ON plasmid for differentiating hiPSCs into skeletal muscle cells via MYOD1 and shOCT4 expression
• Depositing Labs: iPSC Neurodegenerative Disease Initiative (iNDI), Michael Ward
• Publication: Characterization of iPSC lines for the iPSC Neurodegenerative Disease Initiative (iNDI) (unpublished)

Backbone

• Vector backbone: pUCM
• Backbone size w/o insert (bp): 13225
• Total vector size (bp): 14758
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: MYOD1-shOct4
• Species: H. sapiens (human)
• Insert Size (bp): 1492
• Mutation: shOct4
• Entrez Gene: MYOD1 (a.k.a. CMYP17, MYF3, MYOD, MYODRIF, PUM, bHLHc1)
• Promoter: TRE3G

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NruI (unknown if destroyed)
• 5′ sequencing primer: ccgtaccacttcctaccctc

Gene/Insert 2

• Gene/Insert name: puro-T2A-mycNLS-mTagBFP2
• Insert Size (bp): 1474
• Promoter: EF1a
• Tag / Fusion Protein:
  • T2A-mycNLS-mTagBFP2

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SwaI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Resource Information

• Supplemental Documents:
  • K58 PB-TO-MYOD1-shOct4.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry