PB-TO-hNGN2
(Plasmid #172115)

• Purpose: Piggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expression
• Depositing Labs: iPSC Neurodegenerative Disease Initiative (iNDI), Michael Ward
• Publication: Pantazis et al Cell Stem Cell. 2022 Dec 1;29(12):1685-1702.e22. doi: 10.1016/j.stem.2022.11.004.

Backbone

• Vector backbone: pUCM
• Backbone size w/o insert (bp): 13245
• Total vector size (bp): 14092
• Modifications to backbone: CAG-rtTA3G-polyA
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: hNGN2
• Species: H. sapiens (human)
• Insert Size (bp): 819
• Entrez Gene: NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
• Promoter: TRE3G

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHi (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: ccgtaccacttcctaccctc

Gene/Insert 2

• Gene/Insert name: puroR-T2A-mycNLS-mTagBFP2
• Insert Size (bp): 1473
• Promoter: EF1a
• Tag / Fusion Protein:
  • T2A-mycNLS-mTagBFP2

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SwaI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Resource Information

• Supplemental Documents:
  • K4-PB-TO-hNGN2.gbk
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Michael Ward lab
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid has been found to run as a multimer. Plasmid multimerization often does not impact plasmid function, but may reduce transformation efficiencies. You may need to screen multiple colonies to isolate the monomeric version of this plasmid. If you still have trouble isolating the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.