-
PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into lower motor neurons via NGN2, ISL1, and LHX3 expression
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172113 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUCM
- Backbone size w/o insert (bp) 12000
- Total vector size (bp) 16495
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehNGN2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)819
-
Entrez GeneNEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
- Promoter TRE3G
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHi (not destroyed)
- 3′ cloning site BamHi (not destroyed)
- 5′ sequencing primer ccgtaccacttcctaccctc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehISL1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1050
-
Entrez GeneISL1 (a.k.a. ISLET1, Isl-1)
- Promoter TRE3G
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GACGCCAAGCTCACCAAG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namehLHX3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1209
-
Entrez GeneLHX3 (a.k.a. CPHD3, LIM3, M2-LHX3)
- Promoter TRE3G
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer CAGCCTGCTGACATGTGG (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namepuroR-T2A-mycNLS-mTagBFP2
-
Insert Size (bp)1473
- Promoter EF1a
-
Tag
/ Fusion Protein
- T2A-mycNLS-mTagBFP2
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site SwaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMichael Ward lab
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TO-hNIL was a gift from iPSC Neurodegenerative Disease Initiative (iNDI) & Michael Ward (Addgene plasmid # 172113 ; http://n2t.net/addgene:172113 ; RRID:Addgene_172113) -
For your References section:
A reference human induced pluripotent stem cell line for large-scale collaborative studies. Pantazis CB, Yang A, Lara E, McDonough JA, Blauwendraat C, Peng L, Oguro H, Kanaujiya J, Zou J, Sebesta D, Pratt G, Cross E, Blockwick J, Buxton P, Kinner-Bibeau L, Medura C, Tompkins C, Hughes S, Santiana M, Faghri F, Nalls MA, Vitale D, Ballard S, Qi YA, Ramos DM, Anderson KM, Stadler J, Narayan P, Papademetriou J, Reilly L, Nelson MP, Aggarwal S, Rosen LU, Kirwan P, Pisupati V, Coon SL, Scholz SW, Priebe T, Ottl M, Dong J, Meijer M, Janssen LJM, Lourenco VS, van der Kant R, Crusius D, Paquet D, Raulin AC, Bu G, Held A, Wainger BJ, Gabriele RMC, Casey JM, Wray S, Abu-Bonsrah D, Parish CL, Beccari MS, Cleveland DW, Li E, Rose IVL, Kampmann M, Calatayud Aristoy C, Verstreken P, Heinrich L, Chen MY, Schule B, Dou D, Holzbaur ELF, Zanellati MC, Basundra R, Deshmukh M, Cohen S, Khanna R, Raman M, Nevin ZS, Matia M, Van Lent J, Timmerman V, Conklin BR, Johnson Chase K, Zhang K, Funes S, Bosco DA, Erlebach L, Welzer M, Kronenberg-Versteeg D, Lyu G, Arenas E, Coccia E, Sarrafha L, Ahfeldt T, Marioni JC, Skarnes WC, Cookson MR, Ward ME, Merkle FT. Cell Stem Cell. 2022 Dec 1;29(12):1685-1702.e22. doi: 10.1016/j.stem.2022.11.004. 10.1016/j.stem.2022.11.004 PubMed 36459969