HH-gRNA-HDV-Shuttle-Vector
(Plasmid
#169098)
-
PurposeBackbone plasmid to generate HH-gRNA-HDV segment
-
Depositing Lab
-
Depositing OrganizationCalifornia Institute of Technology
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169098 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 169098-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 169098-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCESAx
- Total vector size (bp) 2819
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHH-gRNAbackbone-HDV
-
Insert Size (bp)216
-
GenBank IDNA
- Promoter NA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer tgacattaacctataaaaata
- 3′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 169098-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 169098-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HH-gRNA-HDV-Shuttle-Vector was a gift from Marianne Bronner (Addgene plasmid # 169098 ; http://n2t.net/addgene:169098 ; RRID:Addgene_169098) -
For your References section:
A single-plasmid approach for genome editing coupled with long-term lineage analysis in chick embryos. Gandhi S, Li Y, Tang W, Christensen JB, Urrutia HA, Vieceli FM, Piacentino ML, Bronner ME. Development. 2021 Mar 9. pii: dev.193565. doi: 10.1242/dev.193565. 10.1242/dev.193565 PubMed 33688075