-
PurposeFluorescent reporter for orexin neuropeptides
-
Depositing Lab
-
Depositing OrganizationUniversity of Zurich
Located in Switzerland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169792 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV.hSynapsin1
-
Backbone manufacturerViral Vector Facility - University of Zurich
- Backbone size w/o insert (bp) 4438
- Total vector size (bp) 6481
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameOxLight1
-
SpeciesSynthetic
-
Insert Size (bp)2043
-
GenBank IDMW845970
- Promoter human Synapsin-1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BaMHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gtcgagattaattaactcgagcaggtaag
- 3′ sequencing primer gcaaccaggatttatacaaggaggagaaaat
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV.hSynapsin1.OxLight1 was a gift from Tommaso Patriarchi (Addgene plasmid # 169792 ; http://n2t.net/addgene:169792 ; RRID:Addgene_169792) -
For your References section:
A genetically encoded sensor for in vivo imaging of orexin neuropeptides. Duffet L, Kosar S, Panniello M, Viberti B, Bracey E, Zych AD, Radoux-Mergault A, Zhou X, Dernic J, Ravotto L, Tsai YC, Figueiredo M, Tyagarajan SK, Weber B, Stoeber M, Gogolla N, Schmidt MH, Adamantidis AR, Fellin T, Burdakov D, Patriarchi T. Nat Methods. 2022 Feb;19(2):231-241. doi: 10.1038/s41592-021-01390-2. Epub 2022 Feb 10. 10.1038/s41592-021-01390-2 PubMed 35145320