pHAGE N-mRuby3 (from SARS-CoV-2) IRES puro
(Plasmid
#170466)
-
PurposeThe plasmid codes for the Nucleoprotein (N) of SARS-CoV-2 fused to a mRuby3 fluorescent protein in its C-terminus. Inserted in a lentiviral backbone. Puromycin resistance
-
Depositing Lab
-
Depositing OrganizationCNRS, Delegation Occitanie Est
Located in France -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170466 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHAGE
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNucleocapsid
-
Alt nameNucleoprotein
-
Alt nameSARS-CoV-2 N
-
SpeciesSARS-CoV-2
-
GenBank ID43740575
- Promoter EF1
-
Tag
/ Fusion Protein
- mRuby3 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer TTGAGTTTGGATCTTGGTTC
- 3′ sequencing primer CATATAGACAAAACGCACACC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.09.10.459410v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE N-mRuby3 (from SARS-CoV-2) IRES puro was a gift from Raphael Gaudin (Addgene plasmid # 170466 ; http://n2t.net/addgene:170466 ; RRID:Addgene_170466) -
For your References section:
Pharmacological perturbation of intracellular dynamics as a SARS-CoV-2 antiviral strategy. Bakhache W, Partiot E, Lucansky V, Bare Y, BonaventurB V, Goujon C, Bories C, Deffieu M.S, Gaudin R. bioRxiv 2021 10.1101/2021.09.10.459410