Skip to main content

pJCX4
(Plasmid #170756)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170756 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pJCX4
  • Backbone size (bp) 5409
  • Modifications to backbone
    Derived from pEGFP-C1. The Mxe GyrA intein, chitin binding domain (CBD), and Woodchuck hepatitis virus (WHP) posttranscriptional regulatory element (WPRE) were added to facilitate expression of a target protein in mammalian cells with Mxe GyrA intein - CBD tag fused C-terminally.
  • Vector type
    Mammalian Expression
  • Promoter CMV
  • Tag / Fusion Protein
    • Mxe GyrA intein - chitin binding domain (CBD) (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CMV for: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer Mxe rev: GATTGCCATGCCGGTCAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJCX4 was a gift from Roberto Dominguez (Addgene plasmid # 170756 ; http://n2t.net/addgene:170756 ; RRID:Addgene_170756)
  • For your References section:

    Novel human cell expression method reveals the role and prevalence of posttranslational modification in nonmuscle tropomyosins. Carman PJ, Barrie KR, Dominguez R. J Biol Chem. 2021 Oct;297(4):101154. doi: 10.1016/j.jbc.2021.101154. Epub 2021 Sep 1. 10.1016/j.jbc.2021.101154 PubMed 34478714