pUPD2+E-Luc
(Plasmid
#170873)
-
PurposePhytobrick - E-Luc Luciferase CDS
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 170873-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 170873-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUPD2
-
Backbone manufacturerDiego Orzaez Lab
- Backbone size w/o insert (bp) 2105
-
Vector typeLuciferase, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE-Luc
-
Alt nameEnhanced beetle luciferase
-
SpeciesPyrearinus termitilluminans
-
Insert Size (bp)1630
-
Mutationc.375C>T to remove BbsI site
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer ATAGGCGTATCACGAGGCAG
- 3′ sequencing primer CGAGTCAGTGAGCGAGGAAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOriginal gene from https://doi.org/10.1371/journal.pone.0010011
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.05.26.443018v2 to read the preprint on bioRxiv.
DNA (Catalog # 170873-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 170873-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUPD2+E-Luc was a gift from Markita Landry (Addgene plasmid # 170873 ; http://n2t.net/addgene:170873 ; RRID:Addgene_170873) -
For your References section:
A Ratiometric Dual Color Luciferase Reporter for Fast Characterization of Transcriptional Regulatory Elements in Plants. Gonzalez-Grandio E, Demirer GS, Ma W, Brady S, Landry MP. ACS Synth Biol. 2021 Sep 14. doi: 10.1021/acssynbio.1c00248. 10.1021/acssynbio.1c00248 PubMed 34520169