pDGB1a2R+pNOS_Red-F_NOSt
(Plasmid #170888)

• Purpose: GoldenBraid Transcriptional Unit - pNOS_Red-F_NOSt Reverse orientation
• Depositing Lab: Markita Landry
• Publication: Gonzalez-Grandio et al ACS Synth Biol. 2021 Sep 14. doi: 10.1021/acssynbio.1c00248.

Backbone

• Vector backbone: pDGB1_alpha2R
• Backbone manufacturer: Diego Orzaez Lab
• Backbone size w/o insert (bp): 2594
• Vector type: Plant Expression, Luciferase, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Red-F
• Alt name: Red mutant S286Y luciferase from Luciola curciata
• Species: Luciola curciata
• Insert Size (bp): 2446
• Mutation: p.S286Y Red mutant
• Promoter: pNOS

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: GGGAAACGCCTGGTATCTTT
• 3′ sequencing primer: CCGATCCCCGGAATTAGATC

Resource Information

• Supplemental Documents:
  • 016 - pDGB1a2R+pNOS_RedF_NOSt.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Red-F transcriptional unit in GoldenBraid pDGB1 alpha2R. Insert can be excised by Esp3I digestion. Requires pSOUP for replication in agrobacterium . Please visit https://www.biorxiv.org/content/10.1101/2021.05.26.443018v2 to read the preprint on bioRxiv