Skip to main content

pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Neurog2 x2)
(Plasmid #171100)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171100 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 171100-D50 50 μg of DNA in Tris buffer $495
DNA 171100-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    PX458
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 48138)
  • Vector type
    CRISPR
  • Selectable markers
    mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hSpCas9
  • gRNA/shRNA sequence
    Neurog2 gRNA1: CATCGGGGTCAGGGTCGCCG; Neurog2 gRNA2: CTCCCGAGGTGCCAAGACGG
  • Species
    M. musculus (mouse); S. pyogenes
  • Entrez Gene
    Neurog2 (a.k.a. Atoh4, Math4A, bHLHa8, ngn-2, ngn2)
  • Promoter Ef1a

Cloning Information

  • Cloning method Gateway Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Neurog2 x2) was a gift from Joseph Brzezinski (Addgene plasmid # 171100 ; http://n2t.net/addgene:171100 ; RRID:Addgene_171100)
  • For your References section:

    Initiation of Otx2 expression in the developing mouse retina requires a unique enhancer and either Ascl1 or Neurog2 activity. Kaufman ML, Goodson NB, Park KU, Schwanke M, Office E, Schneider SR, Abraham J, Hensley A, Jones KL, Brzezinski JA. Development. 2021 Jun 15;148(12). pii: 269198. doi: 10.1242/dev.199399. Epub 2021 Jun 18. 10.1242/dev.199399 PubMed 34143204