Skip to main content

miR5 Mm ATP13A2
(Plasmid #171822)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171822 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    SIV tranfserplasmide
  • Backbone manufacturer
    Didier Nègre
  • Backbone size w/o insert (bp) 7445
  • Total vector size (bp) 7514
  • Vector type
    Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ATP13A2
  • gRNA/shRNA sequence
    gccgaaacactcgttatagaa
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Atp13a2 (a.k.a. 1110012E06Rik, AA589443)
  • Promoter SFFV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer TCATTTTACTGGGGGACCTTGTGCA
  • 3′ sequencing primer caacgggccacaactcctc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    miR5 Mm ATP13A2 was a gift from Veerle Baekelandt (Addgene plasmid # 171822 ; http://n2t.net/addgene:171822 ; RRID:Addgene_171822)
  • For your References section:

    ATP13A2 deficiency disrupts lysosomal polyamine export. van Veen S, Martin S, Van den Haute C, Benoy V, Lyons J, Vanhoutte R, Kahler JP, Decuypere JP, Gelders G, Lambie E, Zielich J, Swinnen JV, Annaert W, Agostinis P, Ghesquiere B, Verhelst S, Baekelandt V, Eggermont J, Vangheluwe P. Nature. 2020 Feb;578(7795):419-424. doi: 10.1038/s41586-020-1968-7. Epub 2020 Jan 29. 10.1038/s41586-020-1968-7 PubMed 31996848