MAC-CTSB
(Plasmid
#172413)
-
PurposeMAC-tagged gene expression
-
Depositing Lab
-
Depositing OrganizationUniversity of Helsinki, Institute of Biotechnology
Located in Finland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172413 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
| DNA | 172413-D50 | 50 μg of DNA in Tris buffer | $495 * | ||
| DNA | 172413-D100 | 100 μg of DNA in Tris buffer | $585 * | ||
* Log in to view industry pricing.
Backbone
-
Vector backboneMAC-tag-C
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCathepsin B
-
Alt nameCTSB
-
SpeciesH. sapiens (human)
-
Entrez GeneCTSB (a.k.a. APPS, CPSB, KWE, RECEUP)
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- MAC-tag (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CMVfor :CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer pCR3.1-BGHrev: TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 172413-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 172413-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MAC-CTSB was a gift from Markku Varjosalo (Addgene plasmid # 172413 ; http://n2t.net/addgene:172413 ; RRID:Addgene_172413) -
For your References section:
SARS-CoV-2-host proteome interactions for antiviral drug discovery. Liu X, Huuskonen S, Laitinen T, Redchuk T, Bogacheva M, Salokas K, Pohner I, Ohman T, Tonduru AK, Hassinen A, Gawriyski L, Keskitalo S, Vartiainen MK, Pietiainen V, Poso A, Varjosalo M. Mol Syst Biol. 2021 Nov;17(11):e10396. doi: 10.15252/msb.202110396. 10.15252/msb.202110396 PubMed 34709727