TfR-mCh-DHFR
(Plasmid
#173013)
-
PurposeFor light regulated release of transferrin receptor (TfR) from the endoplasmic reticulum. Driven by CMV promoter.
-
Depositing Lab
-
Depositing OrganizationUniversity of Colorado Denver and Anschutz Medical Campus
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173013 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 173013-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 173013-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepJPA
- Backbone size w/o insert (bp) 4721
- Total vector size (bp) 8225
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTfR-mCh-DHFR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3504
- Promoter CMV
-
Tags
/ Fusion Proteins
- mCherry (C terminal on insert)
- DHFR (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site xmaI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CCTTTCTCTCCACAGGTGTC
- 3′ sequencing primer TGCAATAAACAAGTTGGGCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTfR-mCh was a gift from Dr. Michael Ehlers
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.09.02.278770v1 for bioRxiv preprint.
DNA (Catalog # 173013-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 173013-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TfR-mCh-DHFR was a gift from Matthew Kennedy (Addgene plasmid # 173013 ; http://n2t.net/addgene:173013 ; RRID:Addgene_173013) -
For your References section:
zapERtrap: A light-regulated ER release system reveals unexpected neuronal trafficking pathways. Bourke AM, Schwartz SL, Bowen AB, Kleinjan MS, Winborn CS, Kareemo DJ, Gutnick A, Schwarz TL, Kennedy MJ. J Cell Biol. 2021 Sep 6;220(9). pii: 212461. doi: 10.1083/jcb.202103186. Epub 2021 Jul 9. 10.1083/jcb.202103186 PubMed 34241635
Map uploaded by the depositor.
