DHFR-GFP-th-NL1
(Plasmid #173007)

• Purpose: For light regulated release of neuroligin 1 from the endoplasmic reticulum. Driven by synapsin promoter. Thrombin site is included between GFP and NL1.
• Depositing Lab: Matthew Kennedy
• Publication: Bourke et al J Cell Biol. 2021 Sep 6;220(9). pii: 212461. doi: 10.1083/jcb.202103186. Epub 2021 Jul 9.

Backbone

• Vector backbone: pSynapsin
• Backbone size w/o insert (bp): 3858
• Total vector size (bp): 7497
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DHFR-GFP-NL1
• Insert Size (bp): 3639
• Promoter: human synapsin
• Tags / Fusion Proteins:
  • EGFP (N terminal on insert)
  • DHFR (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: accatctgcgctgcgg
• 3′ sequencing primer: CCATTATAAGCTGCAATAAACAAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Neuroligin ORF was a gift from Dr. Peter Schieffele (Addgene clone #15262)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.09.02.278770v1 for bioRxiv preprint.